Centro de documentación de DVD
La biología del desarrollo prenatal
Español |
Haga clic sobre cualquier superíndice en el texto para ver la nota al pie. Haga clic en cualquier número de nota al pie para ver el texto de origen. Haga clic en el nombre de cualquier escritor para ver la referencia completa en la bibliografía. Luego haga clic en el botón de retroceso de su navegador para volver a la nota al pie del texto de origen.
![]()
[1]
Gasser, 1975, 1.
[2]
Guyton and Hall, 2000, 2;
Lodish et al., 2000, 12.
[3]
Vindla and James, 1995, 598.
[4]
Cunningham et al., 2001, 226;
O'Rahilly and Müller, 2001, 92.
[5]
O'Rahilly and Müller, 1987, 9.
[6]
Spraycar, 1995, 377 & 637.
[7]
O'Rahilly and Müller, 2001, 87.
[8]
Quote from Ayto, 1990, 199.
[9]
El desarrollo humano durante el período embrionario de 8 semanas ha sido dividido en una serie de 23 etapas denominadas etapas de Carnegie. Estas etapas se describen muy bien en O'Rahilly y Müller, 1987. Dado que el desarrollo humano es único y depende de múltiples factores, los diferentes embriones pueden alcanzar determinado hito del desarrollo o cierto tamaño a edades ligeramente diferentes. Este sistema de etapas, aceptado internacionalmente, brinda una forma de describir el desarrollo que es independiente de la edad y el tamaño. Cada una de las 23 etapas de Carnegie tiene características estructurales específicas. Cuando describimos diversos hitos del desarrollo, la etapa de Carnegie en la que se producen se identificará con una designación, como: [Etapa de Carnegie 2]. Consulte el Anexo B para obtener más información relacionada con las etapas embrionarias y asignaciones de edad.
[10]
Moore and Persaud, 2003, 3.
[11]
Moore and Persaud, 2003, 3: "Después del período embrionario (ocho semanas), el ser humano en desarrollo recibe el nombre de feto."
O'Rahilly and Müller, 2001, 87.
[12]
Esta convención, denominada por O'Rahilly "edad posfecundación", ha sido preferida desde hace tiempo por los embriólogos. [consulte Mall, 1918, 400; O'Rahilly y Müller, 1999b, 39; O'Rahilly y Müller, 2001, 88 y 91.] Los obstetras y los radiólogos suelen determinar la edad según el tiempo transcurrido desde el primer día del último período menstrual previo a la fecundación. Es lo que correctamente se denomina "edad posmenstrual" y comienza 2 semanas antes de que se produzca la fecundación. En síntesis: edad posmenstrual = edad posfecundación + 2 semanas. Por ende, la edad posmenstrual equivale aproximadamente a 2 semanas al momento de la fecundación. El término de uso frecuente "edad gestacional" se ha empleado con ambas convenciones de edad y es mejor evitarlo o definirlo cuidadosamente en cada uso.
Página 3
![]()
![]()
[13]
Moore and Persaud, 2003, 16;
O'Rahilly and Müller, 1987, 9: “La fecundación es la secuencia de eventos que comienza cuando un espermatozoide hace contacto con un oocito o sus envolturas y termina con la entremezcla de cromosomas maternos y paternos en la metafase de la primera división mitótica del cigoto.”
Carlson, 2004, 3;
O'Rahilly and Müller, 2001, 8. [Etapa de Carnegie 1]
[14]
O'Rahilly and Müller, 2001, 25: “El término "huevo" debería descartarse del campo de la embriología humana.”
O'Rahilly and Müller, 1987, 9: “Es más conveniente reservarlo para ese objeto nutritivo que se ve frecuentemente en el desayuno.”
[15]
O'Rahilly and Müller, 2001, 23-24.
[16]
O'Rahilly and Müller, 2001, 30.
[17]
Dorland and Bartelmez, 1922, 372;
Gasser, 1975, 1;
Mall, 1918, 421;
O'Rahilly and Müller, 2001, 31.
[18]
Gasser, 1975, 1;
O'Rahilly and Müller, 2001, 33.
[19]
Quote from Saunders, 1970, 1;
Spraycar, 1995, 1976.
[20]
Guyton and Hall, 2000, 34.
[21]
Guyton and Hall, 2000, 24;
Watson and Crick, 1953, 737.
[22]
Guyton and Hall, 2000, 24;
Lodish et al., 2000, 103;
Watson and Crick, 1953, 737.
[23]
Lodish et al., 2000, 456.
[24]
Consulte el Anexo A.
[25]
Consulte el Anexo A.;
Alberts et al., 1998, 189.
[26]
Consulte el Anexo A.
[27]
Hertig, 1968, 26;
Hertig and Rock, 1973, 130;
(cited by O'Rahilly and Müller, 1987, 12);
Shettles, 1958, 400.
[28]
Guyton and Hall, 2000, 34.
[29]
Moore and Persaud, 2003, 33 & 60;
Morton et al., 1992, 72;
Nahhas and Barnea, 1990, 105.
Página 4
![]()
![]()
[30]
Gasser, 1975, 1;
O'Rahilly and Müller, 2001, 37;
Spraycar, 1995, 1130: Mórula deriva de la palabra morus que en latín significa "mora". [Etapa de Carnegie 2]
[31]
O'Rahilly and Müller, 2001, 39. [Etapa de Carnegie 3]
[32]
Gasser, 1975, 1;
O'Rahilly and Müller, 2001, 39;
Sadler, 2005, 6.
[33]
Alberts et al., 1998, 32. Para obtener un análisis y una definición de las células madre embrionarias, consulte el sitio web de los Institutos Nacionales de la Salud.: http://stemcells.nih.gov/infoCenter/stemCellBasics.asp#3
[34]
O'Rahilly and Müller, 2001, 40;
La implantación comienza con la unión del blastocisto aproximadamente 6 días después de la fecundación. [La unión del blastocisto a la pared interna del útero es un evento efímero y es el sello distintivo de la etapa de Carnegie 4].
Adams, 1960, 13-14;
Cunningham et al., 2001, 20;
Hamilton, 1949, 285-286;
Hertig, 1968, 41;
Hertig and Rock, 1944, 182;
Hertig and Rock, 1945, 81 & 83;
Hertig and Rock, 1949, 183;
Hertig et al., 1956, 444. [Etapa de Carnegie 5]
[35]
Chartier et al., 1979, 134;
Cunningham et al., 2001, 27;
O'Rahilly and Müller, 2001, 43.
[36]
Cunningham et al., 2001, 20 & 26-27;
O'Rahilly and Müller, 2001, 31.
[37]
Hertig, 1968, 16;
Cunningham et al., 2001, 86 & 136;
Para obtener una descripción detallada de la placenta, consulte Hamilton y Boyd, 1960. Para obtener una descripción detallada de la vasculatura placentaria, consulte Harris y Ramsey, 1966. Esta separación de la sangre materna y la fetal es casi perfecta pero no tanto, ya que una pequeña cantidad de células fetales pueden encontrarse en la circulación materna y viceversa.
Cunningham et al., 2001, 96 & 136.
[38]
Liley, 1972, 101;
O'Rahilly and Müller, 2001, 78-79.
[39]
Para obtener una descripción detallada de la formación del cordón umbilical, consulte Florian, 1930.
Página 5
![]()
![]()
[40]
O'Rahilly and Müller, 2001, 39.
[41]
Moore and Persaud, 2003, 50;
O'Rahilly and Müller, 2001, 82. [Etapas de Carnegie 5 & 6];
En los seres humanos, el nombre de "saco vitelino" ha perdido popularidad entre algunos embriólogos (incluidos O'Rahilly y Müller), dado que no es un depósito de nutrientes ni contiene vitelo. El nombre técnico preferido es "vesícula umbilical". Esta estructura juega un papel vital en la transferencia de nutrientes de la madre al embrión antes de que la circulación placentaria sea completamente funcional.
[42]
Campbell et al., 1993, 756;
Kurjak et al., 1994, 437;
O'Rahilly and Müller, 2001, 82.
[43]
O'Rahilly and Müller, 1987, 29;
O'Rahilly and Müller, 2001, 43. [Etapas de Carnegie 4-5]
[44]
O'Rahilly and Müller, 2001, 14 & 135. [Etapa de Carnegie 7];
Cabe destacar que existen muchos ejemplos de órganos derivados de múltiples capas germinales. Por ejemplo, el hígado se forma en gran medida a partir del endodermo pero contiene vasos sanguíneos y glóbulos que provienen del mesodermo y nervios de origen ectodérmico.
[45]
Moore and Persaud, 2003, 80 & 83;
Sadler, 2005, 9.
[46]
Bartelmez, 1923, 236;
Müller and O'Rahilly, 1983, 419-420 & 429;
O'Rahilly and Gardner, 1979, 123 & 129;
O'Rahilly and Müller, 1984, 422;
O'Rahilly and Müller, 1987, 90;
O'Rahilly and Müller, 1999a, 47 & 52. [Etapa de Carnegie 9]
[47]
DiFiore and Wilson, 1994, 221;
Fowler et al., 1988, 793;
Grand et al., 1976, 793-794 & 796 & 798;
O'Rahilly, 1978, 125;
O'Rahilly and Boyden, 1973, 238-239;
O'Rahilly and Müller, 1984, 421;
O'Rahilly and Tucker, 1973, 6 & 8 & 23;
Streeter, 1942, 232 & 235.
[48]
Carlson, 2004, 117.
[49]
Gilmour, 1941, 28;
O'Rahilly and Müller, 1987, 86. [Etapa de Carnegie 9]
[50]
Campbell, 2004, 14;
Carlson, 2004, 116 & 446;
Navaratnam, 1991, 147-148;
O'Rahilly and Müller, 1987, 99. [Etapa de Carnegie 10]
[51]
Campbell, 2004, 14;
Carlson, 2004, 430;
De Vries and Saunders, 1962, 96;
Gardner and O'Rahilly, 1976, 583;
Gilbert-Barness and Debich-Spicer, 1997, 650;
Gittenger-de Groot et al., 2000, 17;
van Heeswijk et al., 1990, 151;
Kurjak and Chervenak, 1994, 439;
Navaratnam, 1991, 147-148;
O'Rahilly and Müller, 1987, 99;
Wisser and Dirschedl, 1994, 108. [Etapa de Carnegie 10, posiblemente etapa 9 tardía]
[52]
Moore and Persaud, 2003, 70: "El sistema cardiovascular es el primer sistema orgánico en alcanzar un estado funcional."
[53]
Moore and Persaud, 2003, 78.
[54]
Gasser, 1975, 26;
Moore and Persaud, 2003, 78.
Página 6
![]()
Capítulo 13 Crecimiento del cerebroEl rápido crecimiento cerebral se hace evidente por el aspecto cambiante del prosencéfalo, el mesencéfalo y el rombencéfalo. |
![]()
[55]
Gasser, 1975, 30;
O'Rahilly and Müller, 2001, 80.
[56]
O'Rahilly and Müller, 2001, 81.
[57]
van Heeswijk et al., 1990, 153.
[58]
See Appendix A.
[59]
Gasser, 1975, 49 & 59;
O'Rahilly and Gardner, 1975, 11;
O'Rahilly and Müller, 1985, 148 & 151;
O'Rahilly and Müller, 1987, 143;
Streeter, 1945, 30;
Uhthoff, 1990, 7 & 141. [esbozos de las extremidades superiores e inferiores: etapas de Carnegie 12 y 13]
[60]
Moore and Persaud, 2003, 486;
O'Rahilly, 1957, 459;
O'Rahilly and Müller, 2001, 165.
Para obtener información sobre la técnica de diagnóstico por imagen directa para el primer trimestre utilizada en este programa (denominada embrioscopía), consulte Cullen y col., 1990.
[61]
O'Rahilly and Müller, 1999a, 134;
Sadler, 2005, 106. [Etapa de Carnegie 15]
[62]
Laffont, 1982, 5.
[63]
Bartelmez and Dekaban, 1962, 25;
Campbell, 2004, 17;
O'Rahilly and Gardner, 1979, 130;
O'Rahilly et al., 1984, 249;
O'Rahilly and Müller, 1999a, 115;
van Dongen and Goudie, 1980, 193. [Etapa de Carnegie 14]
[64]
Moore, 1980, 938.
[65]
Guyton and Hall, 2000, 663-677.
Página 7
![]()
Capítulo 16 Vías respiratorias principalesEn el aparato respiratorio, están presentes el bronquio derecho y el izquierdo, los que posteriormente conectarán la tráquea con los pulmones. |
Capítulo 17 Hígado y riñonesSe observa el enorme hígado que llena el abdomen junto al corazón que late. Los riñones permanentes aparecen a las 5 semanas. |
![]()
[66]
Moore and Persaud, 2003, 245;
O'Rahilly and Boyden, 1973, 239;
O'Rahilly and Müller, 2001, 291;
Sparrow et al., 1999, 550.
[67]
Angtuaco et al., 1999, 13;
Lipschutz, 1998, 384;
Moore and Persaud, 2003, 288;
O'Rahilly and Müller, 1987, 167 & 182;
O'Rahilly and Müller, 2001, 301;
Sadler, 2005, 72. [Etapa de Carnegie 14]
[68]
O'Rahilly and Müller, 2001, 23;
Waters and Trainer, 1996, 16;
Witschi, 1948, 70, 77 & 79.
[69]
O'Rahilly and Müller, 1987, 175;
Streeter, 1948, 139. [Etapa de Carnegie 15]
[70]
O'Rahilly and Gardner, 1975, 4. [Etapas de Carnegie 16 & 17]
Página 8
![]()
Capítulo 23 Placas de las manos y ondas cerebralesA las 6 semanas las paletas de las manos se aplanan levemente. Ya a las 6 semanas y 2 días se registran ondas cerebrales primitivas. |
![]()
[71]
Birnholz et al., 1978, 539;
de Vries et al., 1982, 301 & 304: "Se observaron los primeros movimientos a las 7,5 semanas de edad posmenstrual". [o 5½ semanas de edad posfecundación];
Humphrey, 1964, 99: earliest reflex 5½ weeks;
Humphrey, 1970, 12;
Humphrey and Hooker, 1959, 76;
Humphrey and Hooker, 1961, 147;
Kurjak and Chervenak, 1994, 48;
Visser et al., 1992, 175-176: “Los movimientos fetales generados de manera endógena puede observarse por primera vez después de las 7 semanas de edad posmenstrual (es decir, 5 semanas después de la concepción).;”
Natsuyama, 1991, 13;
O'Rahilly and Müller, 1999a, 336: 5½ semanas después de la fecundación;
Sorokin and Dierker, 1982, 723 & 726;
Visser et al., 1992, 175-176;
Natsuyama, 1991, 13: Se observó un movimiento espontáneo en la "etapa de Carnegie 15" (alrededor de 33 días después de la fecundación);
Hogg, 1941, 373: La actividad refleja comienza a las 6½ semanas [ajustado a la edad posfecundación].
[72]
Goodlin, 1979, D-128.
[73]
Karmody and Annino, 1995, 251;
O'Rahilly and Müller, 2001, 480;
Streeter, 1948, 190.
[74]
Kurjak and Chervenak, 1994, 19.
[75]
de Vries et al., 1982, 320.
[76]
Gilbert-Barness and Debich-Spicer, 1997, 774;
Grand et al., 1976, 798;
O'Rahilly and Müller, 1987, 213;
Sadler, 2005, 66;
Spencer, 1960, 9;
Timor-Tritsch et al., 1990, 287.
[77]
O'Rahilly and Müller, 1987, 202-203.
[78]
Borkowski and Bernstine, 1955, 363 (cited by Bernstine, 1961, 63 & 66;
O'Rahilly and Müller, 1999a, 195;
van Dongen and Goudie, 1980, 193.);
Hamlin, 1964, 113.
Para obtener un resumen de la encefalografía fetal dentro del útero (para medir las ondas cerebrales) en el feto casi a término, mediante el uso de electrodos abdominales y vaginales, consulte Bernstine y col., 1955.
Página 9
![]()
Capítulo 24 Formación del pezónAparecen los pezones en los costados del tronco un poco antes de llegar a su ubicación final en la parte frontal del pecho. |
Capítulo 26 7 semanas: hipo y reflejo de sobresaltoSe ha observado hipo a las 7 semanas. Se observan movimientos en las piernas y el reflejo del sobresalto. |
![]()
[79]
O'Rahilly and Müller, 1985, 155: El pezón aparece en las etapas 17 y 18. [41 a 44 días después de la fecundación];
Wells, 1954, 126.
[80]
O'Rahilly and Müller, 2001, 221;
Streeter, 1948, 187.
[81]
Carlson, 2004, 189;
O'Rahilly and Gardner, 1972, 293;
O'Rahilly and Gardner, 1975, 19;
O'Rahilly and Müller, 2001, 385;
Sperber, 1989, 122 & 147. [Etapa de Carnegie 19]
[82]
de Vries et al., 1982, 305 & 311;
Visser et al., 1992, 176.
[83]
de Vries et al., 1988, 96;
Visser et al., 1992, 176.
[84]
Cooper and O'Rahilly, 1971, 292;
James, 1970, 214; Jordaan, 1979, 214;
Streeter, 1948, 192;
Vernall, 1962, 23: "Las cuatro cavidades cardíacas y los vasos principales asociados son evidentes por fuera, y se acercan bastante a las posiciones que ocupan en la edad adulta". [Etapa de Carnegie 18]
[85]
van Heeswijk et al., 1990, 153.
[86]
Straus et al., 1961, 446 (citado por Gardner and O'Rahilly, 1976, 571.): "“…se ha obtenido un electrocardiograma con la configuración clásica P, QRS y T de un embrión humano de 23 mm (Straus, Walker y Cohen, 1961).”
[87]
O'Rahilly and Müller, 2001, 320. [Etapa de Carnegie 20]
[88]
Andersen et al., 1965, 646;
O'Rahilly, 1966, 35;
O'Rahilly and Müller, 1987, 259;
Pearson, 1980, 39;
Streeter, 1951, 193. [Etapa de Carnegie 22] El pigmento dentro de la retina se encuentra presente a partir de alrededor de los 37 días después de la fecundación.;
O'Rahilly, 1966, 25. [Etapa de Carnegie 16]
[89]
Streeter, 1951, 191;
reiterated by O'Rahilly and Müller, 1987, 257.
[90] O'Rahilly and Gardner, 1975, 11;
O'Rahilly and Müller, 1987, 262.
Página 10
![]()
Capítulo 33 Fusión de los párpadosEntre las semanas 7 y 8, los párpados inferior y superior cubren rápidamente los ojos y se unen parcialmente. |
![]()
[91]
O'Rahilly and Müller, 1999a, 288: “El cerebro en la etapa [de Carnegie] 23 está bastante más avanzado morfológicamente que lo que se aprecia habitualmente, a tal punto que es imperioso considerar el aspecto funcional.”
[92]
Jordaan, 1979, 149.
[93]
Hepper et al., 1998, 531;
McCartney and Hepper, 1999, 86.
[94]
Bates, 1987, 534.
[95]
de Vries et al., 1982, 320;
Goodlin and Lowe, 1974, 348;
Humphrey, 1970, 8.
[96]
Liley, 1972, 101.
[97]
de Vries et al., 1982, 311.
[98]
Humphrey, 1964, 102;
Humphrey, 1970, 19.
[99]
Process described by Andersen et al., 1965, 648-649;
O'Rahilly, 1966, 36-37;
O'Rahilly and Müller, 1987, 261. [Etapa de Carnegie 23]
[100]
Connors et al., 1989, 932;
de Vries et al., 1982, 311;
McCray, 1993, 579;
Visser et al.,1992, 177.
[101]
O'Rahilly and Müller, 2001, 304;
Windle, 1940, 118; (Windle informa que la formación de orina comienza a las nueve semanas.)
[102]
Moore and Persaud, 2003, 307;
Waters and Trainer, 1996, 16-17.
[103]
O'Rahilly and Gardner, 1975, 15: “A finales del período embrionario (etapa 23, 8 semanas después de la ovulación), todos los principales elementos esqueléticos, articulares, musculares, neurales y vasculares de las extremidades están presentes en una forma y disposición bastante similares a las de los adultos.” Consulte O'Rahilly, 1957, para obtener un resumen de los tipos de articulaciones y una descripción del desarrollo de las articulaciones de las extremidades durante el período embrionario. Consulte Gray y col., 1957, para obtener un análisis detallado de los huesos y las articulaciones de la mano a lo largo de los períodos embrionario y fetal.
[104]
Hogg, 1941, 407;
Pringle, 1988, 178.
[105]
Hogg, 1941, 387;
O'Rahilly and Müller, 2001, 169.
[106]
Pringle, 1988, 176.
[107]
O'Rahilly and Müller, 2001, 87: “Se calcula que más del 90% de las más de 4500 estructuras con nombre del cuerpo del adulto se tornan evidentes durante el período embrionario (O'Rahilly).”
Página 11
![]()
![]()
[108]
Liley, 1972, 103.
[109]
Campbell, 2004, 24;
de Vries, 1982, 311;
Petrikovsky et al., 1995, 605.
[110]
Robinson and Tizard, 1966, 52;
Valman and Pearson, 1980, 234.
[111]
de Vries et al., 1982, 305-307.
[112]
de Vries et al., 1982, 311.
[113]
Humphrey, 1964, 96;
Humphrey, 1970, 16-17 (cited by Reinis and Goldman,
1980, 232);
Humphrey and Hooker, 1959, 77-78.
[114]
Robinson and Tizard, 1966, 52;
Quote from Valman and Pearson, 1980, 234.
[115]
Andersen et al., 1965, 648-649;
O'Rahilly and Müller, 2001,
465; Pearson, 1980, 39-41.
[116]
O'Rahilly and Müller, 1984, 425. Campbell, 2004, 29.
[117]
O'Rahilly, 1977a, 128;
O'Rahilly, 1977b, 53;
O'Rahilly and Müller, 2001, 327.
[118]
O'Rahilly and Müller, 2001, 25 & 322.
[119]
Campbell, 2004, 28 & 35;
O'Rahilly and Müller, 2001, 336.
[120]
Brenner et al., 1976, 561.
[121]
Goodlin, 1979, D-128;
Humphrey, 1964, 102.
[122]
de Vries et al., 1982, 309.
[123]
Hepper et al., 1991, 1109.
[124]
Grand et al., 1976, 798;
Pringle, 1988, 178;
Sadler, 2005, 66;
Spencer, 1960, 9. [Pringle informa que los intestinos regresan al abdomen durante la novena o décima semana.]
[125]
Cunningham et al., 2001, 133.
[126]
O'Rahilly and Müller, 2001, 170-171.
[127]
Babler, 1991, 95;
Penrose and Ohara, 1973, 201;
Para obtener una visión general de la formación de los rebordes en la piel de las manos, consulte Cummins, 1929.
[128]
Timor-Tritsch et al., 1990, 291.
[129]
Koldovský et al., 1965, 186.
[130]
O'Rahilly and Müller, 2001, 336;
Wilson, 1926, 29.
Página 12
![]()
![]()
[131]
Brenner, 1976, 561.
[132]
Lecanuet and Schaal, 1996, 3;
Miller, 1982, 169;
Mistretta and Bradley, 1975, 80.
[133]
Abramovich and Gray, 1982, 296;
Ramón y Cajal y Martínez, 2003, 154-155, informan haber visualizado defecación (evacuación intestinal) con una ecografía dentro del útero en los 240 fetos estudiados entre las semanas 15 y 41 [edad posmenstrual].
[134]
O'Rahilly and Müller, 2001, 257;
Para obtener una descripción del meconio hecha por Aristóteles, consulte Grand y col., 1976, 791.
[135]
Grand et al., 1976, 806.
[136]
Moore and Persaud, 2003, 105.
[137]
Lecanuet and Schaal, 1996, 2;
Reinis and Goldman, 1980, 232.
[138]
Hepper et al., 1997, 1820.
[139]
Mancia, 1981, 351.
[140]
Bates, 1979, 419.
[141]
Poissonnet et al., 1983, 7;
Poissonnet et al., 1984, 3: En un estudio de 488 fetos, el grupo de Poissonnet descubrió que el tejido adiposo (grasa) aparece en el rostro a partir de las 14 semanas después de la fecundación. Para las 15 semanas, aparece grasa en la pared abdominal, la espalda, los riñones y los hombros. Para las 16 semanas, también hay grasa en todas las extremidades superiores e inferiores.
[142]
Pringle, 1988, 178. [Decimotercera semana después de la fecundación]
[143]
Pringle, 1988, 179.
[144]
Sorokin and Dierker, 1982, 720;
Leader, 1995, 595: Algunas embarazadas informaron de aleteos fetales ya a las 12 semanas (primeros movimientos). Las mujeres también tienden a reconocer con precisión el movimiento fetal en edades fetales más tempranas durante el segundo embarazo o los siguientes, en comparación con su primer embarazo.
[145]
Spraycar, 1995, 1479;
Timor-Tritsch et al., 1976, 70.
Página 13
![]()
![]()
[146]
Giannakoulopoulos et al., 1999, 494 & 498-499;
Glover and Fisk, 1999, 883;
Smith et al., 2000, 161.
Los niveles de cortisol también se elevan después de procedimientos invasivos, transcurridas 21 semanas después de la fecundación.;
Giannakoulopoulos et al., 1994, 80.
[147]
DiFiore and Wilson, 1994, 221-222;
Pringle, 1988, 178. [Existe cierto desacuerdo entre los expertos sobre el momento en que se completa el árbol bronquial. Algunos afirman que se completa ya a las 16 semanas después de la fecundación, mientras que otros sostienen que se produce después del nacimiento.]
[148]
Campbell, 2004, 48;
Moore and Persaud, 2003, 107;
O'Rahilly and Müller, 2001, 168.
[149]
de Vries et al., 1987, 333;
Goodlin and Lowe, 1974, 349;
Okai et al., 1992, 391 & 396;
Romanini and Rizzo, 1995, 121;
Para obtener una descripción del sistema circadiano, consulte Rosenwasser, 2001, 127.;
Vitaterna et al., 2001, 92: Glosario: "Circadiano: término que deriva de la frase en latín 'circa diem', que significa 'alrededor de un día', y que hace referencia a variaciones o ritmos biológicos con un ciclo de aproximadamente 24 horas".
[150]
Lecanuet and Schaal, 1996, 5-6;
Querleu et al., 1989, 410.
[151]
Glover and Fisk, 1999, 882;
Hepper and Shahidullah, 1994, F81;
Querleu et al., 1989, 410;
Sorokin and Dierker, 1982, 725 & 730;
Valman and Pearson, 1980, 233-234.
[152]
Pringle, 1988, 180.
[153]
Hansen and Corbet, 1998, 542.
[154]
O'Rahilly y Müller, 2001, 92, informan que la edad de viabilidad comienza a las 20 semanas de la fecundación; Draper y col., 1999, 1094, anuncian una tasa de supervivencia del 2% a las 20 semanas después de la fecundación, 6% a las 21 semanas y 16% a las 22 semanas.
Moore y Persaud, 2003, 103, informan de viabilidad a las 22 semanas;
Wood y col., 2000, 379, informan de tasas de supervivencia del 11% a las 21 semanas, del 26% a las 22 semanas y del 44% a las 23 semanas (semanas posteriores a la fecundación), según datos de nacimientos prematuros del Reino Unido durante 1995.
Cooper y col. 1998, 976, (figura 2) anuncian que los bebés con un peso al nacer superior a los 500 gramos experimentaron tasas de supervivencia (todas cifras aproximadas) del 28% a las 21 semanas después de la fecundación, 50% a las 22 semanas, 67% a las 23 semanas y 77% a las 24 semanas.
Draper y col., 2003, actualizaron sus tablas de supervivencia de bebés prematuros, publicadas anteriormente, y ahora informan de una tasa de supervivencia total del 7% a las 20 semanas, 15% a las 21 semanas, 29% a las 22 semanas, 47% a las 23 semanas y 65% a las 24 semanas. [Se corrigieron todas las edades a fin de reflejar la edad posfecundación]. Esas tablas de supervivencia se encuentran disponibles en internet en http://bmj.bmjjournals.com/cgi/content/full/319/7217/1093/DC1. Se describe la metodología empleada en su artículo previo (Draper y col., 1999, 1093-1094). Nota: las tablas de supervivencia publicadas reflejan las edades posmenstruales.
Hoekstra y col., 2004, e3, informan de una tasa de supervivencia del 66% a las 23 semanas y 81% a las 24 semanas de "edad gestacional" [no definida específicamente] en nacimientos prematuros de 1996 al 2000 en su centro de Minneapolis, Minnesota.
Página 14
![]()
![]()
[155]
Mediante ecografías en 4D se observan ojos abiertos 22 semanas después de la fecundación en Campbell 2002, 3.;
De Lia, 2002, comunicación personal;
O'Rahilly and Müller, 2001, 465.
Para obtener un estudio ultraestructural detallado de la unión entre los párpados superior e inferior, consulte Andersen y col., 1967, 293.
[156]
Birnholz and Benacerraf, 1983, 517 (citado por Drife, 1985, 778);
See also Campbell, 2002, 3: El profesor Stuart Campbell señala, acertadamente, que los ojos del feto están cerrados la mayor parte del tiempo y un verdadero parpadeo requiere que los ojos estén abiertos. Quizá "reflejo de entrecerrar los ojos" sería un nombre más preciso para referirnos al "reflejo de parpadeo".
[157]
Lecanuet and Schaal, 1996, 9.
[158]
Visser et al., 1989, 285.
[159]
Gerhardt, 1990, 299;
Petrikovsky et al., 1993, 548-549;
Pierson, 1996, 21 & 26.
[160]
Natale et al., 1988, 317.
[161]
Growth of the human brain, 1975, 6;
Mancuso and Palla, 1996, 290.
[162]
Isenberg et al., 1998, 773-774.
[163]
Robinson and Tizard, 1966, 52.
[164]
Noback et al., 1996, 263.
[165]
Lecanuet and Schaal, 1996, 3.
[166]
Lecanuet and Schaal, 1996, 3;
Liley, 1972, 102;
Moore and Persaud, 2003, 219;
Reinis and Goldman, 1980, 227.
[167]
Liley, 1972, 100.
[168]
England, 1983, 29.
Página 15
![]()
![]()
[169]
Glover and Fisk, 1999, 882;
Hepper and Shahidullah, 1994, F81.
[170]
Connors et al., 1989, 932;
de Vries et al., 1985, 117;
Patrick et al., 1980, 26 & 28;
Visser et al., 1992, 178.
[171]
DiPietro et al., 2002, 2: “Uno de los sellos distintivos del desarrollo previo al nacimiento es la coalescencia de patrones de las funciones fetal, conductual y cardíaca en estados del comportamiento, lo que generalmente se considera un reflejo de la integración en desarrollo del sistema nervioso central.”
[172]
Lauria et al., 1995, 467.
[173]
Moore and Persaud, 2003, 108.
[174]
Schaal et al., 2000, 729.
[175]
Liley, 1972, 100.
[176]
Moore and Persaud, 2003, 131.
[177]
Cunningham et al., 2001, 252.
Página 16
![]()
Anexo A − Cálculos
Hasta el sol de ida y vuelta: cómo determinar la longitud del ADN en un adulto
Dado que:
1. La molécula de ADN mide 3,4 × 10-9 m por cada 10 pares bases.[178]
2. Existen tres mil millones (3 × 109) pares bases por célula.
3. Existen aproximadamente cien billones (1014) de células por adulto.
4. La distancia desde la tierra hasta el sol es de aproximadamente noventa y tres millones de millas.
5. Una pulgada equivale a 2,54 cm.
Primer paso Calcule la longitud del ADN en una sola célula:
3,4 × 10-9 m/10 pares de bases × 3 × 109 pares de bases/célula = 1,02 m de ADN por célula
Segundo paso Calcule la longitud total del ADN en los cien billones de células de un adulto:
1,02 m de ADN/célula × 1014 células = 1,02 × 1014 m de ADN por adulto*
Tercer paso Convierta 1,02 × 1014 metros a millas:
1,02 × 1014 m × 100 cm/m × 1 pulg./2,54 cm × 1 pie/12 pulg. × 1 milla/5.280 pies
= 6,3379 × 1010millas de ADN
Cuarto paso Calcule la cantidad de viajes de ida y vuelta entre la tierra y el sol:
6,3379 × 1010 millas de ADN ÷ (93.000.000 millas/viaje × 2 viajes/viaje de ida y vuelta) =
|
340 viajes de ida y vuelta entre la tierra y el sol |
Por lo tanto, si se acomodara de manera lineal el ADN en un solo adulto, superaría los sesenta y tres mil millones de millas de longitud. Es lo suficientemente largo como para extenderse de la tierra al sol de ida y vuelta... 340 veces.
* Hay aproximadamente veinticinco billones de glóbulos rojos en el cuerpo de un adulto.[179] Cabe destacar que los glóbulos rojos contienen ADN desde el comienzo de su fase de maduración, pero este ADN se degenera y no se encuentra en su forma madura. Este cálculo incluye el ADN de glóbulos rojos.
![]()
[178]
Lodish et al., 2000, 104.
[179]
Guyton and Hall, 2000, 2.
Página 17
![]()
Muy poco espacio: cómo calcular la cantidad de bases contenidas en el ADN de una sola célula
La siguiente página contiene una lista de 3.808 letras mayúsculas, cada una de las cuales representa una sola base.
Dado que:
1. A, G, T y C representan, cada una, una base dentro del ADN de una sola célula.
2. Cada línea contiene 68 letras sin espacios que representan 68 bases.
3. Cada página contiene 56 líneas. (Tamaño de la página: 8½ × 11 pulgadas; fuente: Times New Roman; tamaño de la fuente: 10; espacios entre las letras: ninguno; líneas: espaciado simple; márgenes: como se muestra)
4. Cada célula contiene tres mil millones de pares de bases, lo que equivale a seis mil millones de bases.
El cálculo de la cantidad de páginas necesarias para hacer una lista de todas las bases de ADN en una sola célula es el siguiente:
68 bases/línea × 56 líneas/página = 3.808 bases/página
6.000.000.000 bases/célula ÷ 3.808 bases/página = 1.575.630 páginas/célula
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
Página 18
![]()
Control de la temperatura: cómo acercarnos al rango normal de temperatura corporal embrionaria y fetal
Dado que:
1. La placenta mantiene la temperatura embrionaria y fetal entre 0,5 ºC y 1,5 ºC por encima de la temperatura central materna.[180]
2. La temperatura central materna es de aproximadamente 99,6 °F.
3. La fórmula para convertir la temperatura de grados Fahrenheit (ºF) a Celsius (ºC) es:
ºC = 5/9 (ºF - 32)
El cálculo para computar el rango de temperatura corporal embrionaria y fetal es el siguiente:
Primer paso Convierta la temperatura central materna a grados Celsius:
Temperatura central materna en ºC: ºC = 5/9 (99,6 - 32) = 37,56 ºC
Segundo paso Compute los rangos inferiores y superiores de temperatura corporal fetal en grados Celsius:
Rango inferior (Celsius) = temperatura central materna + 0,5 ºC = 37,56 + 0,5 = 38,2 ºC
Rango superior (Celsius) = temperatura central materna + 1,5 ºC = 37,56 + 1,5 = 39,2 ºC
Step 3 Convierta los resultados a grados Fahrenheit:
ºC = 5/9 (ºF - 32) 9/5 ºC = (ºF - 32) ºF = 9/5 ºC + 32
Sustitución para hallar el límite inferior de temperatura corporal fetal
ºF = 9/5 ºC + 32 ºF = 9/5 (38.16) + 32 ºF = 100.7º
Sustitución para hallar el límite superior de temperatura corporal fetal
ºF = 9/5 ºC + 32 ºF = 9/5 (39.16) + 32 ºF = 102.5º
Resumen del rango normal de temperatura corporal fetal y embrionaria
| °F | °C | |
|---|---|---|
| Límite inferior | 100.7 | 38.2 |
| Límite superior | 102.5 | 39.2 |
Página 19
![]()
El ritmo sigue: cómo calcular la cantidad total de latidos antes y después del nacimiento
El período embrionario
| Semana n.° | Frecuencia cardíaca promedio (latidos por minuto) |
Latidos por semana | Actualización del total |
|---|---|---|---|
| 4 | 113.00 | 1,139,040 | 1,139,040 |
| 5 | 132.00 | 1,330,560 | 2,469,600 |
| 6 | 151.00 | 1,522,080 | 3,991,680 |
| 7 | 170.00 | 1,713,600 | 5,705,280 |
| 8 | 169.03 | 1,703,845 | 7,409,125 |
| (Aproximadamente 7,41 millones de latidos durante el período embrionario) | |||
Varios escritores coinciden en que la frecuencia cardíaca alcanza su punto máximo a las 7 semanas. No obstante, las frecuencias cardíacas informadas varían. Van Heeswijk y col. informan de una frecuencia cardíaca máxima de 167 ± 8 latidos por minuto (lpm),[181] mientras que Leeuwen y col. informan de una frecuencia máxima de 175 lpm.[182] Van Lith y col. informan que la mediana de frecuencia cardíaca fetal alcanza su punto máximo en 177 lpm a las 7 semanas.[183] Se escogió la frecuencia cardíaca de ciento setenta (170) lpm como la frecuencia máxima a efectos ilustrativos en este cálculo. Las frecuencias cardíacas desde la semana 7 hasta la semana 38 han sido calculadas por medio de interpolaciones lineales,[184] presuponiendo que las frecuencias cardíacas serán de 170 lpm a las 7 semanas y 140 lpm a término o a las 38 semanas.[185]
(Nota: Las frecuencias cardíacas son aproximadas. Las condiciones de vida y la experiencia individual pueden variar, y lo harán.)
| Semana n.° | Frecuencia cardíaca promedio (latidos por minuto) | Latidos por semana | Actualización del total |
|---|---|---|---|
| 9 | 168.06 | 1,694,090 | 9,103,216 |
| 10 | 167.10 | 1,684,336 | 10,787,551 |
| 11 | 166.13 | 1,674,581 | 12,462,132 |
| 12 | 165.16 | 1,664,826 | 14,126,958 |
| 13 | 164.19 | 1,655,071 | 15,782,029 |
| 14 | 163.23 | 1,645,316 | 17,427,346 |
| 15 | 162.26 | 1,635,562 | 19,062,907 |
| 16 | 161.29 | 1,625,807 | 20,688,714 |
| 17 | 160.32 | 1,616,052 | 22,304,766 |
| 18 | 159.35 | 1,606,297 | 23,911,063 |
| 19 | 158.39 | 1,596,542 | 25,507,605 |
| 20 | 157.42 | 1,586,787 | 27,094,393 |
| 21 | 156.45 | 1,577,033 | 28,671,425 |
| 22 | 155.48 | 1,567,278 | 30,238,703 |
| 23 | 154.52 | 1,557,523 | 31,796,226 |
| 24 | 153.55 | 1,547,768 | 33,343,994 |
| 25 | 152.58 | 1,538,013 | 34,882,008 |
| 26 | 151.61 | 1,528,259 | 36,410,266 |
| 27 | 150.65 | 1,518,504 | 37,928,770 |
| 28 | 149.68 | 1,508,749 | 39,437,519 |
| 29 | 148.71 | 1,498,994 | 40,936,513 |
| 30 | 147.74 | 1,489,239 | 42,425,752 |
| 31 | 146.77 | 1,479,484 | 43,905,237 |
| 32 | 145.81 | 1,469,730 | 45,374,966 |
| 33 | 144.84 | 1,459,975 | 46,834,941 |
| 34 | 143.87 | 1,450,220 | 48,285,161 |
| 35 | 142.90 | 1,440,465 | 49,725,626 |
| 36 | 141.94 | 1,430,710 | 51,156,337 |
| 37 | 140.97 | 1,420,956 | 52,577,292 |
| 38 | 140.00 | 1,411,201 | 53,988,493 |
| (Aproximadamente 54 millones de latidos antes del nacimiento) | |||
Conteo de los latidos durante toda la vida
El período posnatal desde el nacimiento hasta los 80 años
| Year # | Frecuencia cardíaca promedio (latidos por minuto)*[186] | Latidos por año | Actualización del total |
|---|---|---|---|
| 1 | 120 | 63,115,200 | 63,115,200 |
| 2 | 110 | 57,855,600 | 120,970,800 |
| 3 | 103 | 54,173,880 | 175,144,680 |
| 4 | 103 | 54,173,880 | 229,318,560 |
| 5 | 103 | 54,173,880 | 283,492,440 |
| 6 | 103 | 54,173,880 | 337,666,320 |
| 7 | 95 | 49,966,200 | 387,632,520 |
| 8 | 95 | 49,966,200 | 437,598,720 |
| 9 | 95 | 49,966,200 | 487,564,920 |
| 10 | 95 | 49,966,200 | 537,531,120 |
| 11 | 85 | 44,706,600 | 582,237,720 |
| 12 | 85 | 44,706,600 | 626,944,320 |
| 13 | 85 | 44,706,600 | 671,650,920 |
| 14 | 85 | 44,706,600 | 716,357,520 |
| 15 | 80 | 42,076,800 | 758,434,320 |
| 16 | 80 | 42,076,800 | 800,511,120 |
| 17 | 75 | 39,447,000 | 839,958,120 |
| 18 | 75 | 39,447,000 | 879,405,120 |
| 19 | 70 | 36,817,200 | 916,222,320 |
| 20 | 70 | 36,817,200 | 953,039,520 |
| 21-80 | 70 | 2,209,032,000 | 3,162,071,520 |
| (Aproximadamente 3.160.000.000 de latidos desde el nacimiento hasta los 80 años) | |||
| Total calculado de latidos desde un embrión de 3 semanas hasta los 80 años | 3,216,060,000 | ||
| (Aproximadamente 3,2 mil millones de latidos durante toda la vida) | |||
![]()
[181]
van Heeswijk et al., 1990, 153.
[182]
Leeuwen et al., 1999, 265.
[183]
van Lith et al., 1992, 741.
[184]
See Appendix A.
[185]
DiPietro et al., 1996, 2559.
[186]
Frecuencias cardíacas pediátricas apropiadas para la edad, adaptado de Bates, 1987, 541.
Página 20
![]()
Anexo B − Cómo relacionar la edad con la etapa embrionaria
Asignaciones de edad de O'Rahilly y Müller vs. etapas de Carnegie, 1987 a 2001
| Carnegie Stage |
Cantidad de somitas | Mayor longitud (mm) | Convención de edad 1987 (en días PF)*[187] | Convención de edad 1999 (en días PF)*[188] | Convención de edad 2001 (en días PF)*[189] |
|---|---|---|---|---|---|
| 1 | 0.1 - 0.15 | 1 | - | 1 | |
| 2 | 0.1 - 0.2 | 1½ - 3 | 2 - 3 | 2 - 3 | |
| 3 | 0.1 - 0.2 | 4 | 4 - 5 | 4 - 5 | |
| 4 | 0.1 - 0.2 | 5 - 6 | 6 | 6 | |
| 5 | 0.1 - 0.2 | 7 - 12 | 7 - 12 | - | |
| 5a | 0.1 | 7 - 8 | - | 7 - 8 | |
| 5b | 0.1 | 9 | - | 9 | |
| 5c | 0.15 - 0.2 | 11 - 12 | - | 11 - 12 | |
| 6 | 0.2 | 13 | 17 | 17 | |
| 6a | - | - | - | - | |
| 6b | - | - | - | - | |
| 7 | 0.4 | 16 | 19 | 19 | |
| 8 | 1.0 - 1.5 | 18 | 23 | - | |
| 8a | - | - | - | 23 | |
| 8b | - | - | - | 23 | |
| 9 | 1-3 | 1.5 - 2.5 | 20 | 26 | 25 |
| 10 | 4-12 | 2 - 3.5 | 22 | 29 | 28 |
| 11 | 13-20 | 2.5 - 4.5 | 24 | 30 | 29 |
| 12 | 21-29 | 3 - 5 | 26 | 31 | 30 |
| 13 | 30+ | 4 - 6 | 28 | 32 | 32 |
| 14 | 5 - 7 | 32 | 33 | 33 | |
| 15 | 7 - 9 | 33 | 35 | 36 | |
| 16 | 8 - 11 | 37 | 37 | 38 | |
| 17 | 11 - 14 | 41 | 40 | 41 | |
| 18 | 13 - 17 | 44 | 42 | 44 | |
| 19 | 16 - 18 | 47½ | 44 | 46 | |
| 20 | 18 - 22 | 50½ | 47 | 49 | |
| 21 | 22 - 24 | 52 | 50 | 51 | |
| 22 | 23 - 28 | 54 | 52 | 53 | |
| 23 | 27 - 31 | 56½ | 56 | 56 |
* Días PF = días posfecundación
Los embriólogos han adoptado un sistema de clasificación internacional que divide el desarrollo humano durante el período embrionario en 23 etapas (en un principio, propuestas por Mall, descriptas por Streeter y modificadas por O'Rahilly y Müller en 1987).[190] Dichas etapas recibieron el nombre de etapas de Carnegie. Para que se incluyan en determinada etapa embrionaria se requieren características internas y externas particulares. Estas etapas son independientes de la edad y la longitud. El uso del término "etapa" debería reservarse para hacer referencia a este sistema diseñado por O'Rahilly y Müller en múltiples publicaciones.
Además del sistema de etapas embrionarias humanas, de aceptación prácticamente mundial, se han propuesto diversas asignaciones de edad para cada etapa embrionaria. Streeter creía que el período embrionario comprendía unos 47 ó 48 días en lugar del período de 56 días aceptado actualmente. Endowment for Human Development adopta la convención definida por O'Rahilly y Müller en 1987, que ha obtenido aprobación masiva, pero no universal. O'Rahilly y Müller han propuesto desde entonces modificar esta convención en vista de los datos de ecografías transvaginales que informados en una comunicación personal del Dr. Josef Wisser en 1992.[191] Estas propuestas alternativas están a disposición del lector interesado.
Por ejemplo, desde hace tiempo se describe el comienzo de la contracción cardíaca embrionaria (comienzo del latido) como un evento de la etapa de Carnegie 10, o posiblemente finales de la etapa 9.[192] Nosotros informamos que este evento se produce a las 3 semanas y 1 día (22 días) después de la fecundación, usando la convención de 1987. Otros pueden informar de este evento a los 28 ó 29 días, como se mostró anteriormente. Hay un artículo interesante escrito por Wisser y Dirschedl, quienes informaron el uso de ecografías transvaginales para visualizar el latido embrionario a los 23 días después de la fecundación en dos embriones fecundados in vitro "con una edad... conocida con precisión" y "en embriones de 2 mm de la mayor longitud hacia adelante".[193] Este hallazgo coincide más estrechamente con la convención de edad de 1987. Schats y col. registraron la actividad cardíaca más temprana a los 25 días después de la aspiración folicular en embriones fecundados in vitro.[194] Tezuka y col. registraron la actividad cardíaca más temprana a los 23 días después de la fecundación de embriones concebidos de manera natural.[195]
Existe una variación considerable en el desarrollo normal humano durante el período posnatal. El período prenatal no presenta diferencias con respecto a las variaciones de tamaño, índice de crecimiento y orden de aparición de algunas estructuras o funciones. Nadie sabe con total seguridad el rango de edad exacto para cada etapa. Es posible que se modifiquen estas aproximaciones en el futuro a medida que haya investigaciones rigurosas y cuidadosas que se publiquen y nos aporten nuevos conocimientos.
![]()
[187]
O'Rahilly and Müller, 1987, 3. Los datos de mayor longitud son básicamente uniformes a lo largo de los diversos textos.
[188]
O'Rahilly and Müller, 1999a. Varias páginas.
[189]
O'Rahilly and Müller, 2001, 490. Tabla A-1: sin cambios básicamente desde la edición de 1996. La convención de 2001 difiere muy poco de la de 1999, según lo indicado.
[190]
O'Rahilly and Müller, 2001, 3.
[191]
O'Rahilly and Müller, 1999a, 13.
[192]
See footnote #51.
[193]
Quotes from Wisser and Dirschedl, 1994, 108.
[194]
Schats et al., 1990, 989.
[195]
Tezuka, 1991, 211.
Página 21
![]()
Bibliografía
Abramovich D, Gray E. 1982. Physiological fetal defecation in midpregnancy. Obstet Gynecol. 60(3):294-296.
Search EHD Ref./Abstract
Adams WE. 1960. Early human development. N Z Med J. 59:7-17.
Search EHD Ref./Abstract
Alberts B, Bray D, Johnson A, Lewis J, Raff M, Roberts K, Walter P. 1998. Essential cell biology. New York: Garland.
Search EHD
Andersen H, Ehlers N, Matthiessen ME. 1965. Histochemistry and development of the human eyelids. Acta Opthalmol. 43(5):642-668.
Search EHD Ref./Abstract
Andersen H, Ehlers N, Matthiessen ME, Claesson MH. 1967. Histochemistry and development of the human eyelids II. Acta Opthalmol. 45(3):288-293.
Search EHD Ref./Abstract
Angtuaco TL, Collins HB, Quirk JG. 1999. The fetal genitourinary tract. Semin Roentgenol. 34(1):13-28.
Search EHD Ref./Abstract
Ayto J. 1990. Dictionary of word origins. New York: Arcade.
Search EHD
Babler WJ. 1991. Embryologic development of epidermal ridges and their configurations. In: Plato CC, Garruto RM, Schaumann BA, editors. Dermatoglyphics: science in transition. New York: Wiley-Liss; p. 95-112.
Search EHD Ref./Abstract
Bartelmez GW. 1923. The subdivisions of the neural folds in man. J Comp Neurol. 35(3):231-247.
Search EHD
Bartelmez GW, Dekaban AS. 1962. The early development of the human brain. Carnegie Institution of Washington. Contrib Embryol. 35:13-32.
Search EHD
Bates B. 1979. A guide to physical examination. 2nd ed. Philadelphia: J.B. Lippincott.
Search EHD
Bates B. 1987. A guide to physical examination. 4th ed. Philadelphia: J.B. Lippincott.
Search EHD
Bernstine RL. 1961. Fetal electrocardiography and electroencephalography. Springfield: Charles C. Thomas.
Search EHD
Bernstine RL, Borkowski WJ, Price AH. 1955. Prenatal fetal electroencephalography. Am J Obstet Gynecol. 70(3):623-30.
Search EHD Ref./Abstract
Birnholz JC, Stephens JC, Faria M. 1978. Fetal movement patterns: a possible means of defining neurologic developmental milestones in utero. Am J Roentgenol. 130(3):537-540.
Search EHD Ref./Abstract
Birnholz JC, Benacerraf BR. 1983. The development of human fetal hearing. Science. 222(4623):516-518.
Search EHD Ref./Abstract Full Text
Borkowski WJ, Bernstine RL. 1955. Electroencephalography of the fetus. Neurology. 5(5):362-365.
Search EHD Ref./Abstract
Brenner WE, Edelman DA, Hendricks CH. 1976. A standard of fetal growth for the United States of America. Am J Obstet Gynecol. 126(5):555-564.
Search EHD Ref./Abstract
Campbell J, Wathen N, Perry G, Soneji S, Sourial N, Chard T. 1993. The coelomic cavity: an important site of materno-fetal nutrient exchange in the first trimester of pregnancy. Br J Obstet Gynaecol. 100(8):765-767.
Search EHD Ref./Abstract
Campbell S. 2002. 4D, or not 4D: that is the question. Ultrasound Obstet Gynecol. 19(1):1-4.
Search EHD Ref./Abstract Full Text
Campbell S. 2004. Watch me grow: A unique 3-dimensional week-by-week look at your baby's behavior and development in the womb. New York: St. Martins.
Search EHD
Carlson BM. 2004. Human embryology & developmental biology. 3rd ed. Philadelphia: Mosby.
Search EHD
Chartier M, Roger M, Barrat J, Michelon B. 1979. Measurement of plasma human chorionic gonadotropin (hCG) and ß-hCG activities in the late luteal phase: evidence of the occurrence of spontaneous menstrual abortions in infertile women. Fertil Steril. 31(2):134-137.
Search EHD Ref./Abstract
Connors G, Hunse C, Carmichael L, Natale R, Richardson B. 1989. Control of fetal breathing in the human fetus between 24 and 34 weeks' gestation. Am J Obstet Gynecol. 160(4):932-938.
Search EHD Ref./Abstract
Cooper M, O'Rahilly R. 1971. The human heart at seven postovulatory weeks. Acta Anat. 79(2):280-299.
Search EHD Ref./Abstract
Cooper TR, Berseth CL, Adams JM, Weisman LE. 1998. Actuarial survival in the premature infant less than 30 weeks' gestation. Pediatrics. 101(6):975-978.
Search EHD Ref./Abstract Full Text
Cullen MT, Reece EA, Whetham J, Hobbins JC. 1990. Embryoscopy: description and utility of a new technique. Am J Obstet Gynecol. 162:82-86.
Search EHD Ref./Abstract
Cummins H. 1929. The topographic history of the volar pads (walking pads; tasballen) in the human embryo. Carnegie Institution of Washington. Contrib Embryol. 20:103-126.
Search EHD
Cunningham FG, Gant NF, Leveno KJ, Gilstrap LC, Hauth JC, Wenstrom KD, editors. 2001. Williams Obstetrics. 21st ed. New York: McGraw-Hill.
Search EHD
Página 22
![]()
De Lia, Julian E., M.D. Medical Director of International Institute for the Treatment of Twin to Twin Transfusion Syndrome, personal communication, November 2002.
Search EHD
de Vries JIP, Visser GHA, Prechtl HFR. 1982. The emergence of fetal behaviour. I. Qualitative aspects. Early Hum Dev. 7(4):301-322.
Search EHD Ref./Abstract
de Vries JIP, Visser GHA, Prechtl HFR. 1985. The emergence of fetal behaviour. II. Quantitative aspects. Early Hum Dev. 12(2):99-120.
Search EHD Ref./Abstract
de Vries JIP, Visser GHA, Prechtl HFR. 1988. The emergence of fetal behaviour. III. Individual differences and consistencies. Early Hum Dev. 16(1):85-103.
Search EHD Ref./Abstract
de Vries JIP, Visser GHA, Mulder EJH, Prechtl HFR. 1987. Diurnal and other variations in fetal movement and heart rate patterns at 20-22 weeks. Early Hum Dev. 15(6):333-348.
Search EHD Ref./Abstract
de Vries PA, Saunders JB. 1962. Development of the ventricles and spiral outflow tract in the human heart. Carnegie Institution of Washington. Contrib Embryol. 37:87-114.
Search EHD
DiFiore JW, Wilson JM. 1994. Lung development. Semin Pediatr Surg. 3(4):221-232.
Search EHD Ref./Abstract
DiPietro JA, Costigan KA, Pressman EK. 2002. Fetal state concordance predicts infant state regulation. Early Hum Dev. 68(1):1-13.
Search EHD Ref./Abstract Full Text
DiPietro JA, Hodgson DM, Costigan KA, Hilton SC. 1996. Fetal neurobehavioral development. Child Dev. 67(5):2553-2567.
Search EHD Ref./Abstract
Dorland WAN, Bartelmez GW. 1922. Clinical and embryological report of an extremely early tubal pregnancy; together with a study of decidual reaction, intra-uterine and ectopic. II. Am J Obstet Gynecol. 4(3):372-386.
Search EHD
Drife JO. 1985. Can the fetus listen and learn? Br J Obstet Gynaecol. 92(8):777-778.
Search EHD Ref./Abstract
Draper ES, Manktelow B, Field DJ, James D. 1999. Prediction of survival for preterm births by weight and gestational age: retrospective population based study. Br Med J. 391(7217):1093-97.
Search EHD Ref./Abstract Full Text
Draper ES, Manktelow B, Field DJ, James D. 2003. Prediction of survival for preterm births. Br Med J.; 327(7419):872. [Full text article available from: http://bmj.bmjjournals.com/cgi/eletters/319/7217/1093/DC1#37045; Survival tables available from: http://bmj.bmjjournals.com/cgi/content/full/319/7217/1093/DC1. [cited 2004 Feb 2]
Search EHD Ref./Abstract Full Text
England MA. 1983. Color atlas of life before birth, normal fetal development. Chicago: Year Book Medical.
Search EHD
Fowler CL, Pokorny WJ, Wagner ML, Kessler MS. 1988. Review of bronchopulmonary foregut malformations. J Pediatr Surg. 23(9):793-797.
Search EHD Ref./Abstract
Florian J. 1930. The formation of the connecting stalk and the extension of the amniotic cavity towards the tissue of the connecting stalk in young human embryos. J Anat. 64:454-476.
Search EHD
Gardner E, O'Rahilly R. 1976. The nerve supply and conducting system of the human heart at the end of the embryonic period proper. J Anat. 121(3):571-587.
Search EHD Ref./Abstract Full Text
Gasser RF. 1975. Atlas of human embryos. Maryland: Harper & Row.
Search EHD Full Text
Gerhardt KJ. 1990. Prenatal and perinatal risks of hearing loss. Semin Perinatol. 14(4):299-304.
Search EHD Ref./Abstract
Giannakoulopoulos X, Sepulveda W, Kourtis P, Glover V, Fisk NM. 1994. Fetal plasma cortisol and β-endorphin response to intrauterine needling. Lancet. 344(8915):77-81.
Search EHD Ref./Abstract
Giannakoulopoulos X, Teixeira J, Fisk N, Glover V. 1999. Human fetal and maternal noradrenaline responses to invasive procedures. Pediatr Res. 45(4 Pt 1):494-499.
Search EHD Ref./Abstract Full Text
Gilbert-Barness E, Debich-Spicer D. 1997. Cardiovascular system. In: Gilbert-Barness, editor. Potter's Pathology of the Fetus and Infant. Vol 1. St. Louis: Mosby.
Search EHD
Gilmour JR. 1941. Normal haemopoiesis in intra-uterine and neonatal life. J Pathol Bacteriol. 52:25-55.
Search EHD
Gittenger-de Groot AC, Bartelings MM, Poelmann RE. 2000. Normal and abnormal cardiac development. In: Allan L, Hornberger LK, Sharland G, editors. Textbook of fetal cardiology. London: Greenwich Medical Media Limited; p. 15-27.
Search EHD
Glover V, Fisk N. 1999. Fetal pain: implications for research and practice. Br J Obstet Gynaecol. 106(9):881-886.
Search EHD Ref./Abstract
Goodlin RC. 1979. Care of the fetus. New York: Masson.
Search EHD
Goodlin RC, Lowe EW. 1974. Multiphasic fetal monitoring, a preliminary evaluation. Am J Obstet Gynecol. 119(3):341-357.
Search EHD Ref./Abstract
Grand RJ, Watkins JB, Torti FM. 1976. Development of the human gastrointestinal tract. A review. Gastroenterology. 70(5 Pt. 1):790-810.
Search EHD Ref./Abstract
Gray DJ, Gardner E, O'Rahilly R. 1957. The prenatal development of the skeleton and joints of the human hand. Am J Anat. 101(2):169-223.
Search EHD Ref./Abstract
Growth of the human brain: some further insights. 1975. Nutr Rev. 33(1):6-7.
Search EHD Ref./Abstract
Guyton AC, Hall JE. 2000. Textbook of medical physiology. 10th ed. Philadelphia: W.B. Saunders.
Search EHD
Página 23
![]()
Hamilton WJ. 1949. Early stages of human development. Ann R Coll Surg Eng. 4:281-294.
Search EHD
Hamilton WJ, Boyd JD. 1960. Development of the human placenta in the first three months of gestation. J Anat. 94:297-328.
Search EHD Ref./Abstract Full Text
Hamlin H. 1964. Life or death by EEG. JAMA. 90(2):112-114.
Search EHD Ref./Abstract
Hansen T, Corbet A. 1998. Lung development and function. In: Taeusch HW, Ballard RA, Fletcher J, editors. Avery's diseases of the newborn. W.B. Saunders; p. 541-542.
Search EHD
Harris JWS, Ramsey EM. 1966. The morphology of human uteroplacental vasculature. Carnegie Institution of Washington. Contrib Embryol. 38:43-58.
Search EHD
Hepper PG, Shahidullah BS. 1994. Development of fetal hearing. Arch Dis Child. 71(2):F81-F87.
Search EHD Ref./Abstract
Hepper PG, Shahidullah S, White R. 1991. Handedness in the human fetus. Neuropsychologia. 29(11):1107-1111.
Search EHD Ref./Abstract Full Text
Hepper PG, Shannon EA, Dornan JC. 1997. Sex differences in fetal mouth movements. Lancet. 350(9094):1820-1821.
Search EHD Ref./Abstract
Hepper PG, McCartney GR, Shannon EA. 1998. Lateralised behavior in first trimester human foetuses. Neuropsychologia. 36(6):531-534.
Search EHD Ref./Abstract Full Text
Hertig AT, Rock J. 1944. On the development of the early human ovum, with special reference to the trophoblast of the pre-villous stage: a description of 7 normal and 5 pathologic human ova. Am J Obstet Gynecol. 47(2):149-184.
Search EHD
Hertig AT, Rock J. 1945. Two human ova of the pre-villous stage, having a developmental age of about seven and nine days respectively. Carnegie Institution of Washington. Contrib Embryol. 200:67-84.
Search EHD
Hertig AT, Rock J. 1949. Two human ova of the pre-villous stage, having a developmental age of about eight and nine days respectively. Carnegie Institution of Washington. Contrib Embryol. 221:171-186.
Search EHD
Hertig AT, Rock J. 1973. Searching for early fertilized human ova. Gynecol Invest. 4:121-139.
Search EHD Ref./Abstract
Hertig AT, Rock J, Adams EC. 1956. A description of 34 human ova within the first 17 days of development. Am J Anat. 98(3):435-493.
Search EHD Ref./Abstract
Hertig AT. 1968. Human trophoblast. Springfield: Thomas.
Search EHD
Hoekstra RE, Ferrara B, Couser RJ, Payne NR, Connett JE. 2004. Survival and long-term neurodevelopmental outcome of extremely premature infants born at 23–26 weeks' gestational age at a tertiary center. Pediatrics. 113(1 Pt 1):e1-e6.
Search EHD Ref./Abstract Full Text
Hogg ID. 1941. Sensory nerves and associated structures in the skin of human fetuses of 8 to 14 weeks of menstrual age correlated with functional capability. J Comp Neur. 75:371-410.
Search EHD
Humphrey T. 1964. Growth and maturation of the brain - some correlations between the appearance of human fetal reflexes and the development of the nervous system. In: Dominick P, Purpura DP, Schadé JP, editors. Progress in brain research, Vol 4. Amsterdam: Elsevier; p. 93-135.
Search EHD
Humphrey T. 1970. The development of human fetal activity and its relation to postnatal behavior. Advances in child development and behavior, Vol 5. Reese HW, Lipsitt LP, editors. New York: Academic.
Search EHD Ref./Abstract
Humphrey T, Hooker D. 1959. Double simultaneous stimulation of human fetuses and the anatomical patterns underlying the reflexes elicited. J Comp Neurol. 112:75-102.
Search EHD Ref./Abstract
Humphrey T, Hooker D. 1961. Reflexes elicited by stimulating perineal and adjacent areas of human fetuses. Trans Am Neurol Assoc. 86:147-152.
Search EHD Ref./Abstract
Isenberg SJ, Apt L, McCarty J, Cooper LL, Lim L, Signore MD. 1998. Development of tearing in preterm and term neonates. Arch
Ophthalmol. 116(6):773-776.
Search EHD Ref./Abstract Full Text
James T. 1970. Cardiac conduction system: fetal and postnatal development. Am J Cardiol. 25(2):213-226.
Search EHD Ref./Abstract Full Text
Jordaan H. 1979. Development of the central nervous system in prenatal life. Obstet Gynecol. 53(2):146-150.
Search EHD Ref./Abstract
Karmody CS, Annino DJ. 1995. Embryology and anomalies of the external ear. Facial Plast Surg. 2(4):251-256.
Search EHD Ref./Abstract
Koldovský O, Heringová A, Jirsová V, Jirásek JE, Uher J. 1965. Transport of glucose against a concentration gradient in everted sacs of jejunum and ileum of human fetuses. Gastroenterology. 48(2):185-187.
Search EHD Ref./Abstract
Kurjak A, Chervenak FA, editors. 1994. The fetus as a patient. New York: Parthenon.
Search EHD Ref./Abstract
Kurjak A, Kupesic S, Kostovic L. 1994. Vascularization of yolk sac and vitelline duct in normal pregnancies studied by transvaginal color and pulsed doppler. J Perinat Med. 22:433-440.
Search EHD Ref./Abstract
Página 24
![]()
Laffont J. 1982. Embryology of the brain. J Neuroradiol. 9:5-14.
Search EHD Ref./Abstract
Lauria MR, Gonik B, Romero R. 1995. Pulmonary hypoplasia: pathogenesis, diagnosis and antenatal prediction. Obstet Gynecol. 86(3):467-475.
Search EHD Ref./Abstract Full Text
Leader LR. 1995. Studies in fetal behaviour. Br J Obstet Gynaecol. 102(8):595-597.
Search EHD Ref./Abstract
Lecanuet JP, Schaal B. 1996. Fetal sensory competencies. Eur J Obstet Gynecol Reprod Biol. 68(1-2):1-23.
Search EHD Ref./Abstract
Leeuwen PV, Lange S, Betterman H, Grönemeyer D, Hatzmann W. 1999. Fetal heart rate variability and complexity in the course of pregnancy. Early Hum Dev. 54(3):259-269.
Search EHD Ref./Abstract Full Text
Liley AW. 1972. The foetus as a personality. Aust N Z J Psychiatry. 6(2):99-105.
Search EHD Ref./Abstract
Lipschutz JH. 1998. Molecular development of the kidney: a review of the results of gene disruption studies. Am J Kidney Dis. 31(3):383-397.
Search EHD Ref./Abstract Full Text
Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, Darnell J. 2000. Molecular cell biology. 4th ed. New York: W.H. Freeman.
Search EHD
Mall FP. 1918. On the age of human embryos. Am J Anat. 23:397-422.
Search EHD
Mancia M. 1981. On the beginning of mental life in the foetus. Int J Psychoanal. 62:351-357.
Search EHD Ref./Abstract
Mancuso S, Palla G. 1996. Intrauterine nutrition and development. Adv Contracept. 12(4):285-291.
Search EHD Ref./Abstract
McCartney G, Hepper P. 1999. Development of lateralized behavior in the human fetus from 12 to 27 weeks' gestation. Dev Med Child Neurol. 41(2):83-86.
Search EHD Ref./Abstract
McCray PB. 1993. Spontaneous contractility of human fetal airway smooth muscle. Am J Respir Cell Mol Biol. 8(5):573-580.
Search EHD Ref./Abstract
Miller AJ. 1982. Deglutition. Physiol Rev. 62(1):129-181.
Search EHD Ref./Abstract Full Text
Mistretta CM, Bradley RM. 1975. Taste and swallowing in utero. Br Med Bull. 31(1):80-84.
Search EHD Ref./Abstract Full Text
Moore KL. 1980. Clinically oriented anatomy. Baltimore: Williams & Wilkins.
Search EHD
Moore KL, Persaud TVN. 2003. The developing human, clinically oriented embryology. 7th ed. Philadelphia: W.B. Saunders.
Search EHD
Morton H, Rolfe BE, Cavanaugh AC. 1992. Early pregnancy factor. Semin Reprod Endocrinol. 10(2):72-82.
Search EHD
Müller F, O'Rahilly R. 1983. The first appearance of the major divisions of the human brain at stage 9. Anat Embryol. 168(3):419-432.
Search EHD Ref./Abstract
Nahhas F, Barnea E. 1990. Human embryonic origin early pregnancy factor before and after implantation. Am J Reprod Immunol. 22(3-4):105-108.
Search EHD Ref./Abstract
Natale R, Nasello-Paterson C, Connors G. 1988. Patterns of fetal breathing activity in the human fetus at 24 to 28 weeks of gestation. Am J Obstet Gynecol. 158(2):317-321.
Search EHD Ref./Abstract
National Institutes of Health (NIH). http://www.nih.gov/. Bethesda: NIH; public domain. [updated 2002 Sep; cited 2004 Feb 2]. Available from:
http://stemcells.nih.gov/infoCenter/stemCellBasics.asp#3
Search EHD
Natsuyama E. 1991. In utero behavior of human embryos at the spinal-cord stage of development. Biol Neonate. 60(Suppl 1):11-29.
Search EHD Ref./Abstract
Navaratnam V. 1991. Organisation and reorganisation of blood vessels in embryonic development. Eye. 5(Pt 2):147-150.
Search EHD Ref./Abstract
Noback CR, Strominger NL, Demarest RJ. 1996. The human nervous system. 5th ed. Baltimore: Williams & Wilkins.
Search EHD
Página 25
![]()
Okai T, Kozuma S, Shinozuka N, Kuwabara Y, Mizuno M. 1992. A study on the development of sleep-wakefulness cycle in the human fetus. Early Hum Dev. 29(1-3):391-396.
Search EHD Ref./Abstract
O'Rahilly R. 1957. The development of joints. Ir J Med Sci. 171(382):456-61.
Search EHD Ref./Abstract
O'Rahilly R. 1966. The early development of the eye in staged human embryos. Carnegie Institution of Washington. Publ. 626. Contrib Embryol. 38:1-42.
Search EHD
O'Rahilly R. 1977a. The development of the vagina in the human. Birth Defects Orig Artic Ser. 13(2):123-136.
Search EHD Ref./Abstract
O'Rahilly R. 1977b. Prenatal human development. In: Wynn RM, editor. The biology of the uterus. 2nd ed. New York: Plenum.
Search EHD
O'Rahilly R. 1978. The timing and sequence of events in the development of the human digestive system and associated structures during the embryonic period proper. Anat Embryol. 153(2):123-136.
Search EHD Ref./Abstract
O'Rahilly R, Boyden EA. 1973. The timing and sequence of events in the development of the human respiratory system during the embryonic period proper. Z Anat Entwicklungsgesch.. 141(3):237-250.
Search EHD Ref./Abstract
O'Rahilly R, Gardner E. 1972. The initial appearance of ossification in staged human embryos. Am J Anat. 134(3):291-308.
Search EHD Ref./Abstract
O'Rahilly R, Gardner E. 1975. The timing and sequence of events in the development of the limbs in the human embryo. Anat Embryol. 148(1):1-23.
Search EHD Ref./Abstract
O'Rahilly R, Gardner E. 1979. The initial development of the human brain. Acta Anat. 104(2):123-133.
Search EHD Ref./Abstract
O'Rahilly R, Müller F. 1984. Chevalier Jackson lecture. Respiratory and alimentary relations in staged human embryos. New embryological data and congenital anomalies. Ann Otol Rhinol Laryngol. 93(5 Pt 1):421-429.
Search EHD Ref./Abstract
O'Rahilly R, Müller F. 1985. The origin of the ectodermal ring in staged human embryos of the first 5 weeks. Acta Anat. 122(3):145-157.
Search EHD Ref./Abstract
O'Rahilly R, Müller F. 1987. Developmental stages in human embryos. Washington: Carnegie Institution.
Search EHD
O'Rahilly R, Müller F. 1999a. The embryonic human brain: an atlas of developmental stages. 2nd ed. New York: Wiley-Liss.
Search EHD
O'Rahilly R, Müller F. 1999b. Minireview: summary of the initial development of the human nervous system. Teratology. 60(1):39-41.
Search EHD Ref./Abstract Full Text
O'Rahilly R, Müller F. 2001. Human embryology and teratology. 3rd ed. New York: Wiley-Liss.
Search EHD
O'Rahilly R, Müller F, Hutchins GM, Moore GW. 1984. Computer ranking of the sequence of appearance of 100 features of the brain and related structures in staged human embryos during the first 5 weeks of development. Am J Anat. 171(3):243-257.
Search EHD Ref./Abstract
O'Rahilly R, Tucker JA. 1973. The early development of the larynx in staged human embryos. Part I: Embryos of the first five weeks (to stage 15). Ann Otol Rhinol Laryngol. 82:1-27.
Search EHD Ref./Abstract
Patrick J, Campbell K, Carmichael L, Natale R, Richardson B. 1980. Patterns of human fetal breathing during the last 10 weeks of pregnancy. Obstet Gynecol. 56(1):24-30.
Search EHD Ref./Abstract
Pearson AA. 1980. The development of the eyelids. Part I. External features. J Anat. 130(1):33-42.
Search EHD Ref./Abstract Full Text
Penrose LS, Ohara PT. 1973. The development of epidermal ridges. J Med Genet. 10(3):201-208.
Search EHD Ref./Abstract
Petrikovsky BM, Kaplan GP, Pestrak H. 1995. The application of color Doppler technology to the study of fetal swallowing. Obstet Gynecol. 86(4 Pt 1):605-608.
Search EHD Ref./Abstract Full Text
Petrikovsky B, Schifrin B, Diana L. 1993. Effects of fetal acoustic stimulation on fetal swallowing and amniotic fluid index. Obstet Gynecol. 81(4):548-550.
Search EHD Ref./Abstract
Pierson LL. 1996. Hazards of noise exposure on fetal hearing. Semin Perinatol. 20(1):21-29.
Search EHD Ref./Abstract
Poissonnet CM, Burdi AR, Bookstein FL. 1983. Growth and development of human adipose tissue during early gestation. Early Hum Dev. 8(1):1-11.
Search EHD Ref./Abstract
Poissonnet CM, Burdi AR, Garn SM. 1984. The chronology of adipose tissue appearance and distribution in the human fetus. Early hum Dev. 10(1-2):1-11.
Search EHD Ref./Abstract
Pringle KC. 1988. A reassessment of pregnancy staging. Fetal Ther. 3(3):173-184.
Search EHD Ref./Abstract
Querleu D, Renard X, Boutteville C, Crepin G. 1989. Hearing by the human fetus? Semin Perinatol. 13(5):409-420.
Search EHD Ref./Abstract
Ramón y Cajal CL, Martinez RO. 2003. Defecation in utero: a physiologic fetal function. Am J Obstet Gynecol. 188(1):153-6.
Search EHD Ref./Abstract Full Text
Reinis S, Goldman JM. 1980. Prenatal and early postnatal development of brain function. The development of the brain: biological and functional perspectives. Springfield: Charles C. Thomas.
Search EHD
Robinson RJ, Tizard JPM. 1966. Central nervous system in the new-born. Br Med Bull. 22(1):49-55.
Search EHD Ref./Abstract Full Text
Romanini C, Rizzo G. 1995. Fetal behaviour in normal and compromised fetuses. An overview. Early Hum Dev. 43(2):117-131.
Search EHD Ref./Abstract Full Text
Rosenwasser AM. 2001. Alcohol, antidepressants, and circadian rhythms. Alcohol Res Health. 25(2):126-135.
Search EHD Ref./Abstract Full Text
Página 26
![]()
Sadler TW. 2005. Langman's essential embryology. Philadelphia: Lippincott Williams & Wilkins.
Search EHD
Saunders JW. 1970. Patterns and principles of animal development. New York: Macmillan.
Search EHD
Schaal B, Marlier L, Soussignan R. 2000. Human foetuses learn odours from their pregnant mother's diet. Chem Senses. 25(6):729-737.
Search EHD Ref./Abstract Full Text
Schats R, Jansen CA, Wladimiroff JW. 1990. Embryonic heart activity: Appearance and development in early pregnancy. Br J Obstet Gynaecol. 97(11):989-994.
Search EHD Ref./Abstract
Shettles LB. 1958. The living human ovum. Am J Obstet Gynecol. 76:398-406.
Search EHD Ref./Abstract
Smith RP, Gitau R, Glover V, Fisk NM. 2000. Pain and stress in the human fetus. Eur J Obstet Gynecol Reprod Biol. 92(1):161-5.
Search EHD Ref./Abstract Full Text
Sorokin Y, Dierker LJ. 1982. Fetal movement. Clin Obstet Gynecol. 25(4):719-734.
Search EHD Ref./Abstract
Sparrow MP, Weichselbaum M, McCray PB. 1999. Development of the innervation and airway smooth muscle in human fetal lung. Am J Respir Cell Mol Biol. 20(4):550-560.
Search EHD Ref./Abstract Full Text
Spencer RP. 1960. The intestinal tract. Springfield: Charles C. Thomas.
Search EHD
Sperber GH. 1989. Craniofacial embryology. 4th ed. London: University.
Search EHD
Spraycar M, editor. 1995. Stedman's medical dictionary. 26th ed. Baltimore: Williams & Wilkins.
Search EHD
Straus R, Walker RH, Cohen M. 1961. Direct electrocardiographic recording of a twenty-three millimeter human embryo. Am J Cardiol. 8:443-447.
Search EHD
Streeter GL. 1942. Developmental horizons in human embryos – description of age group XI, 13 to 20 somites, and age group XII, 21 to 29 somites. Carnegie Institution of Washington. Publ. 541. Contrib Embryol. 30(197):209-244.
Search EHD
Streeter GL. 1945. Developmental horizons in human embryos – description of age group XIII, embryos about 4 or 5 millimeters long, and age group XIV, period of indentation of the lens vesicle. Carnegie Institution of Washington. Publ. 557. Contrib Embryol. 31(199):27-63.
Search EHD
Streeter GL. 1948. Developmental horizons in human embryos – description of age groups XV, XVI, XVII, and XVIII, being the third issue of a survey of the Carnegie collection. Carnegie Institution of Washington. Publ. 575. Contrib Embryol. 32(211):133-203.
Search EHD
Streeter GL. 1951. Developmental horizons in human embryos – description of age groups XIX, XX, XXI, XXII, and XXIII, being the fifth issue of a survey of the Carnegie collection. Carnegie Institution of Washington. Publ. 592. Contrib Embryol. 34(230):165-196.
Search EHD
Tezuka N, Sato S, Kanasugi H, Hiroi M. 1991. Embryonic heart rates: development in early first trimester and clinical evaluation. Gynecol Obstet Invest. 32(4):210-212.
Search EHD Ref./Abstract
Timor-Tritsch IE, Zador I, Hertz RH, Rosen MG. 1976. Classification of human fetal movement. Am J Obstet Gynecol. 126(1):70-77.
Search EHD Ref./Abstract
Timor-Tritsch IE, Peisner DB, Raju S. 1990. Sonoembryology: an organ-oriented approach using a high-frequency vaginal probe. J Clin Ultrasound. 18(4):286-298.
Search EHD Ref./Abstract
Uhthoff HK. 1990. The embryology of the human locomotor system. Berlin: Springer-Verlag.
Search EHD
Valman HB, Pearson JF. 1980. What the fetus feels. Br Med J. 280(6209):233-234.
Search EHD Ref./Abstract Full Text
van Dongen LGR, Goudie EG. 1980. Fetal movement patterns in the first trimester of pregnancy. Br J Obstet Gynaecol. 87(3):191-193.
Search EHD Ref./Abstract
van Heeswijk M, Nijhuis JG, Hollanders HMG. 1990. Fetal heart rate in early pregnancy. Early Hum Dev. 22(3):151-156.
Search EHD Ref./Abstract
van Lith JM, Visser GH, Mantingh A, Beekhuis JR. 1992. Fetal heart rate in early pregnancy and chromosomal disorders. Br J Obstet Gynaecol. 99(9):741-744.
Search EHD Ref./Abstract
Vernall DG. 1962. The human embryonic heart in the seventh week. Am J Anat. 111:17-24.
Search EHD Ref./Abstract
Vindla S, James D. 1995. Fetal behaviour as a test of fetal wellbeing. Br J Obstet Gynaecol. 102(8):597-600.
Search EHD Ref./Abstract
Visser GHA, Mulder HH, Wit HP, Mulder EJH, Prechtl HFR. 1989. Vibro-acoustic stimulation of the human fetus: effect on behavioral state organization. Early Hum Dev. 19(4):285-296.
Search EHD Ref./Abstract
Visser GH, Mulder EJ, Prechtl HF. 1992. Studies on developmental neurology in the human fetus. Dev Pharmacol Ther. 18(3-4):175-183.
Search EHD Ref./Abstract
Vitaterna MH, Takahashi JS, Turek FW. 2001. Overview of circadian rhythms. Alcohol Res Health. 25(2):85-92.
Search EHD Ref./Abstract Full Text
Waters BL, Trainer TD. 1996. Development of the human fetal testis. Pediatr Pathol Lab Med. 16(1):9-23.
Search EHD Ref./Abstract
Watson JD, Crick FHC. 1953. Molecular structure of nucleic acids, a structure for deoxyribose nucleic acid. Nature. 171(4356):737-738.
Search EHD Ref./Abstract
Wells LJ. 1954. Development of the human diaphragm and pleural sacs. Carnegie Institution of Washington. Publ. 603. Contrib Embryol. 35:107-134.
Search EHD
Wilson KM. 1926. Correlation of external genitalia and sex-glands in the human embryo. Carnegie Institution of Washington. Publ. 363. Contrib Embryol. 18:23-30.
Search EHD
Windle WF. 1940. Physiology of the fetus. Philadelphia: W.B. Saunders.
Search EHD
Wisser J, Dirschedl P. 1994. Embryonic heart rate in dated human embryos. Early Hum Dev. 37:107-115.
Search EHD Ref./Abstract
Witschi E. 1948. Migration of the germ cells of human embryos from the yolk sac to the primitive gonadal folds. Carnegie Institution of Washington. Publ. 575. Contrib Embryol. 32:67-80.
Search EHD
Wood NS, Marlow N, Costeloe K, Gibson AT, Wilkinson AR. 2000. Neurologic and developmental disability after extremely premature birth. N Engl J Med. 343(6):378-384.
Search EHD Ref./Abstract Full Text
Página 27
![]()
Nombres completos de las publicaciones citadas
| Abreviación de la publicación | Nombre completo de la publicación |
|---|---|
| Acta Anat | Acta Anatomica |
| Acta Opthalmol | Acta Ophthalmologica |
| Adv Contracept | Advances in Contraception |
| Alcohol Res Health | Alcohol Research & Health |
| Am J Anat | The American Journal of Anatomy |
| Am J Cardiol | The American Journal of Cardiology |
| Am J Kidney Dis | American Journal of Kidney Diseases |
| Am J Obstet Gynecol | American Journal of Obstetrics and Gynecology |
| Am J Reprod Immunol | American Journal of Reproductive Immunology and Microbiology |
| Am J Respir Cell Mol Biol | American Journal of Respiratory Cell and Molecular Biology |
| Am J Roentgenol | American Journal of Roentgenology |
| Anat Embryol | Anatomy and Embryology |
| Ann Otol Rhinol Laryngol | The Annals of Otology, Rhinology, and Laryngology |
| Ann R Coll Surg Eng | Annals of the Royal College of Surgeons of England |
| Arch Dis Child | Archives of Disease in Childhood |
| Arch Ophthalmol | Archives of Ophthalmology |
| Aust N Z J Psychiatry | The Australian and New Zealand Journal of Psychiatry |
| Biol Neonate | Biology of the Neonate |
| Birth Defects Orig Artic Ser | Birth Defects Original Article Series |
| Br J Obstet Gynaecol | British Journal of Obstetrics and Gynaecology |
| Br Med Bull | British Medical Bulletin |
| Br Med J | British Medical Journal |
| Chem Senses | Chemical Senses |
| Child Dev | Child Development |
| Clin Obstet Gynecol | Clinical Obstetrics and Gynecology |
| Contrib Embryol | Contributions to Embryology |
| Dev Med Child Neurol | Developmental Medicine and Child Neurology |
| Dev Pharmacol Ther | Developmental Pharmacology and Therapeutics |
| Early Hum Dev | Early Human Development |
| Eur J Obstet Gynecol Reprod Biol | European Journal of Obstetrics, Gynecology, and Reproductive Biology |
| Eye | Eye |
| Facial Plast Surg | Facial Plastic Surgery |
| Fertil Steril | Fertility and Sterility |
| Fetal Ther | Fetal Therapy |
| Gastroenterology | Gastroenterology |
| Gynecol Invest | Gynecologic Investigation |
| Gynecol Obstet Invest | Gynecologic and Obstetric Investigation |
| Int J Psychoanal | The International Journal of Psycho-Analysis |
| Ir J Med Sci | Irish Journal of Medical Science |
| J Clin Ultrasound | Journal of Clinical Ultrasound |
| J Comp Neurol | The Journal of Comparative Neurology |
| J Med Genet | Journal of Medical Genetics |
| J Comp Neurol | Journal of Neuroradiology |
| J Pathol Bacteriol | The Journal of Pathology and Bacteriology |
| J Pediatr Surg | Journal of Pediatric Surgery |
| J Perinat Med | Journal of Perinatal Medicine |
| J Anat | Journal of Anatomy |
| JAMA | JAMA : The Journal of the American Medical Association |
| Lancet | Lancet |
| N Engl J Med | The New England Journal of Medicine |
| N Z Med J | New Zealand Medical Journal |
| Nature | Nature |
| Neurology | Neurology |
| Neuropsychologia | Neuropsychologia |
| Nutr Rev | Nutrition Reviews |
| Obstet Gynecol | Obstetrics & Gynecology |
| Pediatr Pathol Lab Med | Pediatric Pathology & Laboratory Medicine |
| Pediatr Res | Pediatric Research |
| Pediatrics | Pediatrics |
| Physiol Rev | Physiological Reviews |
| Science | Science |
| Semin Pediatr Surg | Seminars in Pediatric Surgery |
| Semin Perinatol | Seminars in Perinatology |
| Semin Reprod Endocrinol | Seminars in Reproductive Endocrinology |
| Semin Roentgenol | Seminars in Roentgenology |
| Teratology | Teratology |
| Trans Am Neurol Assoc | Transactions of the American Neurological Association |
| Ultrasound Obstet Gynecol | Ultrasound in Obstetrics & Gynecology |
| Z Anat Entwicklungsgesch | Zeitschrift fur Anatomie und Entwicklungsgeschichte |
Página 28
![]()



